Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Western blot analysis of SH3KBP1 protein levels in total protein extracts obtained from growing (GM) or differentiating C2C12 cells (from 1 to 5 days). C2C12 differentiation is assessed by Myogenin expression and Tubulin is used as loading control. ( B ) RT-qPCR analysis of Sh3kbp1 gene expression level relative to housekeeping genes ( CycloB, Gapdh, GusB, Rpl41 , and Tbp ) in proliferating C2C12 cells (GM) or in differentiating C2C12 (1 to 5 days of differentiation). ( C ) Representative western blots analysis of SH3KBP1 protein downregulation in stable cell line constitutively expressing shRNA construct targeting Sh3kbp1 . Tubulin is used as loading control. ( D , E ) Representative immunofluorescence staining of myosin heavy chain (green) and myonuclei (red) in C2C12 stable cell lines expressing scramble shRNA ( D ) or shRNA targeting Sh3kbp1 ( E ) after 3 or 6 days of differentiation. Zooms are magnifications of images in white dots rectangles in 6 days old myotubes. Scale bars: 150 µm, 15 µm in zoom. ( F , G ) Representatives immunofluorescent staining of myosin heavy chain (green) and myonuclei (red) in stable cell line expressing Sh3kbp1 shRNA, co-transfected with plasmid coding either for mCherry ( F ) or the full-length human SH3KBP1 ( G ) after 5 days of differentiation. Scale bar: 150 µm. ( H ) Quantification of the percentage of myonuclei per clusters observed in ( D – G ) experiments. Statistical analysis performed using unpaired t tests where * P < 0.05; ** P < 0.01; *** P < 0.001. Comparison between shRNA Scramble and ShRNA- sh3kbp1 ( n = 8; biological replicates) for the “4–6” nuclei category P = 0.000014, for the “7–9” nuclei category P = 0.039, for the “10–15” nuclei category P = 0.00016 and for the “+ 15” nuclei category P = 0.004. Comparison between ShRNA- sh3kbp1 and ShRNA- sh3kbp1 + SH3KBP1 ( n = 3; biological replicates) for the “4–6” nuclei category P = 0.00008, for the “10–15” nuclei category P = 0.0076 and for the “+ 15” nuclei category P = 0.04. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Western Blot, Expressing, Control, Quantitative RT-PCR, Gene Expression, Stable Transfection, shRNA, Construct, Immunofluorescence, Staining, Transfection, Plasmid Preparation, Comparison, Software

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) Representative immunofluorescence staining of 5 days C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA and stained with sirTubulin ® . Scale bars, 10 µm. ( B ) Quantification of the microtubule bundle directionality (orientation angle normalized according to myotubes longitudinal axis) in myotubes using the “directionality plugin” of ImageJ ® . Data are pooled from three independent repeats ( n = 41 cells in scramble condition and n = 61 cells in Sh3kbp1 shRNA condition). “−90°” category P = 0.03; “+80°” category P = 0.02“ + 90°” category P = 0.017. Statistical analysis performed using unpaired t tests where * P < 0.05. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( C, D ) Representative images of immunofluorescent staining of Pericentrin (red), PCM1 (green) and nuclei (Blue) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Scale bars, 10 µm. ( E , F ) Quantification of the myonuclei peripheral staining of Pericentrin ( E ) or PCM1 ( F ) in 5 days differentiated C2C12 myotubes expressing either scramble or Sh3kbp1 shRNA. Data are pooled from three independent repeats. Error bars represent SD ( G ) MAP7 constructs used in the experiment. ( H ) Representative western blot of crude extracts of C2C12 cells expressing various GFP-MAP7 constructs (FL: Full length, NT: N-terminal part of MAP7; NTL: N-terminal long part of MAP7; M: Middle part of MAP7, CT: C-terminal part of MAP7 and CTL: C-terminal long part of MAP7) and GFP-DNM2 and stained for endogenous SH3KBP1 (top) or with anti-GFP (bottom) antibodies. ( I ) Representative western blot after GFP immunoprecipitation (MAP7 and DNM2 constructs) using GFP-Trap in C2C12 cell extracts ( H ). The membrane was revealed with anti-GFP (bottom) and anti-SH3KBP1 (Top) antibodies n .>3.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Immunofluorescence, Staining, Expressing, shRNA, Software, Construct, Western Blot, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A ) SH3KBP1 constructs used in the experiment. ( B ) Representative western blot of crude extracts of C2C12 cells co-expressing GFP-DNM2 and various Flag-SH3KBP1 constructs (FL full length, N-term N-terminal part of SH3KBP1, C-term C-terminal part of SH3KBP1) and stained with anti-GFP (top) or anti-Flag (bottom) antibodies. ( C ) Representative western blot after DNM2-GFP immunoprecipitation using GFP-Trap and aforementioned C2C12 cell extracts ( B ). The membrane was revealed with anti-GFP (top), anti-Flag (middle) and anti-SH3KBP1 (bottom) antibodies. ( B , C ) Blots were repeated more than three times. ( D ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DNM2 (red) and myonuclei (blue) (single Z plan). Scale bars, 10 µm. ( E ) Representative images of extracted Tibialis Anterior muscle fiber stained for SH3KBP1 (green), DHPR1α (for DyHydroPyridine Receptor alpha, red) and myonuclei (blue) (Max intensity of Z stacks plans). Scale bars, 10 µm. ( F ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue) in the time course of C2C12 cells differentiation: proliferation (Prolif) and 3 or 5 days of differentiation (diff day 3, diff day 5) are presented. ( G ) Representative immunofluorescent staining of SH3KBP1 (green), Actin (red) and myonuclei (blue or red) along the time course of primary myoblasts cells differentiation: proliferation (Prolif) and 3 or 10 days of differentiation (diff day 3, diff day 10) are presented. Scale bars, 10 µm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Construct, Western Blot, Expressing, Staining, Immunoprecipitation, Membrane

Journal: EMBO Reports

Article Title: SH3KBP1 promotes skeletal myofiber formation and functionality through ER/SR architecture integrity

doi: 10.1038/s44319-025-00413-9

Figure Lengend Snippet: ( A , B ) Representative Immunofluorescent staining of Golgi (RCAS1, red) ( A ) or Endoplasmic Reticulum (ERP72, red) ( B ) and myonuclei (DAPI, blue) in 6 days differentiated C2C12 cells expressing either scramble-GFP-shRNA or GFP-shRNA targeting Sh3kbp1 gene. Scale bars, 100 µm. Zooms 1–4 are magnifications of the images in white dots. Scale bars: 100 µm. ( C ) GFP-tagged SH3KBP1 constructs used in the experiment. ( D ) Representative western blot performed on crude extracts of C2C12 cells expressing GFP-SH3KBP1 constructs and stained with anti-ERP72 (Top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. ( E ) Representative western blot performed after SH3KBP1-GFP construct immunoprecipitation (GFP trap assay) of C2C12 cells extracts ( D ) and stained with anti-ERP72 (top), anti-Calnexin (middle) and anti-GFP (bottom) antibodies. Blots were repeated more than three times. ( F ) Representative immunofluorescent images of GFP-SH3KBP1 constructs expression in 10 days cultured primary myofibers. (GFP, green; Actin, red and myonuclei, blue) Scale bars, 5 µm. ( G ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes, differentiated for 6 days, were analyzed for their content of LC3-I/LC3-II and SH3KBP1 proteins by western blot; Actin labeling was used as a loading control. ( H ) Fold change quantification of LC3-II/Actin ratios reported to the Scramble condition. ( n = 3; biological replicates) P = 0.002. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( I ) Control (Sh-Scramble) and SH3KBP1-depleted (Sh- Sh3kbp1 ) C212 myotubes differentiated for 6 days were either left untreated or treated with 100 nM of bafilomycin-A1 during 6 h. After total protein extraction, LC3-I/LC3-II and Actin levels were analyzed by immunoblot. ( J ) Fold change quantification of LC3-II/Actin ratios reported to the untreated condition in each condition (Scramble or Sh3KBP1) ( n = 3; biological replicates) P = 0.0011. Statistical analysis performed using unpaired t tests where ** P < 0.01. ( K ) Quantification of the percentage of highly LC3-II positive myofibers in Tibialis Anterior muscles from WT or KI- Dnm2 R465W/+ injected with either PBS or shRNA targeting SH3KBP1 mRNA ( n > 3; biological replicates). Comparison between WT and WT-ShRNA- sh3kbp1 P = 0.0059, KI-DNM2 R465W and KI-DNM2 R465W -ShRNA- sh3kbp1 P = 0.0056. Statistical analysis performed using unpaired t tests where ** P < 0.01. Boxplot whiskers represent the maximum and minimum data values. Center lines show the medians; box limits indicate the 25th and 75th percentiles as determined by R software and represents the middle 50% of observed values. ( L ) Representative electron microscopy images of myofibrils and triads organization within Flexor digitalis Brevis muscles from WT mice injected with either PBS or AAV cognate vector expressing shRNA targeting SH3KBP1 mRNA. Scale bar = 0.2 µm or 100 nm.

Article Snippet: Inhibition of autophagy maturation was performed by treating C2C12 myotubes with Bafilomycin-A1 (MedChemExpress, HY-100558) at 100 nM during 6 h. To generate C2C12 stably expressing shRNAs (shControl or shCin85), cells were transfected with plasmids encoding control shRNA (Mission pLKO.1-Puro non-mammalian shRNA control plasmid, Merck SHC002) or shRNA directed against SH3KBP1 (mission shRNA clone TRCN0000088508 targeting the 3’UTR sequence CCCACCACTCTAAGAGAAATT) and selected using 2 μg/mL of Puromycin (Gibco, A1113803) for 2 weeks.

Techniques: Staining, Expressing, shRNA, Construct, Western Blot, Immunoprecipitation, TRAP Assay, Cell Culture, Control, Labeling, Protein Extraction, Muscles, Injection, Comparison, Software, Electron Microscopy, Plasmid Preparation

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Hyperammonemia impairs protein synthesis in myotubes. (A) Representative immunoblotting and densitometry of puromycin incorporation in untreated C2C12 myotubes (UnT) or those treated with 10 mM ammonium acetate (AmAc) for 6 h and 24 h. (B) Heat map of transcriptome analysis comparing untreated C2C12 myotubes to those treated with 10 mM AmAc for 3 or 24 h. (C) Heat map of C2C12 myotubes after 24 h of treatment with AmAc compared with untreated cells. (D) Ingenuity Pathway Knowledge Base (IPKB) analysis of the most enriched canonical pathways present in differentiated C2C12 myotubes after 24 h of hyperammonemia. (E) Ingenuity Pathway Analysis of the β-catenin (CTNNB1) node from the entire transcriptome (from panel B). Note that the majority of connections are downregulated upon AmAc treatment (indicated in red). (F) Cellular RNA levels from untreated myotubes or those treated with 10 mM AmAc for 6 or 24 h; from the gastrocnemius muscle of portocaval anastomosis (PCA) and sham-operated, pair-fed control (Sham) rats (n = 5 in each group); and from the skeletal muscle of patients with cirrhosis (CIR) and healthy controls (CTL) (n = 5 in each group). (G) Fold changes of the expression levels of the 45S rRNA in C2C12 myotubes treated with 10 mM AmAc for 30 min or 3, 6, or 24 h in the gastrocnemius muscle of portocaval anastomosis (PCA) and sham-operated pair-fed control rats (n = 5 each) and the skeletal muscle of patients with cirrhosis and controls (n = 5 each). rRNA expression was normalized against β-actin. (H) RNA gel of 28S and 18S bands in untreated myotubes and those treated with 10 mM AmAc for different times. (I) Effect of AmAc treatment on the polysome/monosome ratio in C2C12 myotubes. Representative polysome profiles from a sucrose gradient (20 to 47%) were obtained by taking the optical density at 254 nm (OD254) for untreated control and 10 mM AmAc-treated C2C12 cell extracts. Positions of 80S and polysome species are indicated. A.U., arbitrary units. All cellular experiments were performed in at least 3 biological replicates, and data are expressed as means ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (versus the control).

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Western Blot, Control, Expressing

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Hyperammonemia impairs skeletal muscle ribosomal biogenesis. (A) Relative fold changes in expression of ribosomal RPL5, RPL23, and RPL32 mRNAs, comparing myotubes treated with 10 mM AmAc for 6 or 24 h with untreated (UnT) controls, measured by RT-quantitative PCR (qRT-PCR). (B) Relative fold changes in expression of ribosomal RPS9, RPS19, and RPS26 mRNAs, comparing myotubes treated with 10 mM AmAc for 6 or 24 h with untreated controls, measured by qRT-PCR. (C to E) Representative immunoblotting and densitometry of expression of ribosomal proteins RPL5, RPL23, and RPL32 from untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h (C); from the gastrocnemius muscle of portocaval anastomosis (PCA) and sham-operated, pair-fed control (Sham) rats (n = 5 each) (D); and from the skeletal muscle of patients with cirrhosis (CIR) and controls (CTL) (n = 5 each) (E). (F) Representative immunoblotting and densitometry of ribosomal biogenesis markers RPL5, RPL23, and RPL32 in untreated HEK cells and those treated with 10 mM AmAc for 6 or 24 h. (G) Representative immunoblotting and densitometry of expression of ribosomal proteins RPL5, -23, and -32 show that with 24 h of treatment with the translational inhibitor cycloheximide (CHX), there is reduced expression of ribosomal proteins, which is blocked by proteasome inhibition. However, the expression of a housekeeping gene, β-actin, did not change in response to these interventions, and the expression of a regulatable, nonhousekeeping gene (P70S6K) did not change, except with cycloheximide treatment, which resulted in lower expression levels than in untreated cells. All cellular experiments were performed in at least 3 biological replicates, and all data were normalized to β-actin and are expressed as means ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (versus untreated cells or controls for all panels).

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Control, Inhibition

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Reduced skeletal muscle β-catenin expression during hyperammonemia. (A to C) Representative immunoblotting and densitometry of cMYC and upstream binding factor 1 (UBF1) expression in untreated (UnT) murine C2C12 myotubes or those treated with 10 mM AmAc for 24 h (A); skeletal muscle from portocaval anastomosis (PCA) and sham-operated, pair-fed (Sham) control rats (n = 5 each) (B); and skeletal muscle of patients with cirrhosis (CIR) and controls (CTL) (n = 5 each) (C). (D to F) Representative immunoblotting and densitometry of total (T) and active, dephosphorylated (A) β-catenin expression from untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h (D); from the gastrocnemius muscle of PCA and sham-operated, pair-fed control rats (n = 5 each) (E); and from the skeletal muscle of patients with cirrhosis and control subjects (n = 5 each) (F). (G) Representative immunoblotting and densitometry of total and activated β-catenin as well as its transcriptional targets cMYC and UBF1 in untreated HEK cells or those treated with 10 mM ammonium acetate for 6 or 24 h. (H) Luciferase activity measuring transcriptional activity of β-catenin using Topflash reporter activity (normalized to Renilla) comparing untreated myotubes and those treated for 24 h with 10 mM AmAc, 5 mM lithium chloride (LiCl), or 2 μM BIO (6-bromoindirubin-3′-oxime) (small-molecule inhibitor of GSK3β with resultant activation of β-catenin), expressed as fold changes over untreated cells. (I) Representative photomicrographs of immunofluorescence of active, unphosphorylated β-catenin expression (green) in murine C2C12 myotubes treated with 10 mM AmAc or 2 μM BIO for 24 h. Nuclei are counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (blue). Scale bars, 40 μm. **, P < 0.01; ***, P < 0.001 (versus untreated cells). All data are expressed as means ± SD. All cellular experiments were performed in at least 3 biological replicates, and all blots were normalized to β-actin. The antibody against active β-catenin recognizes the unphosphorylated, stable form of β-catenin.

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Expressing, Western Blot, Binding Assay, Control, Luciferase, Activity Assay, Activation Assay, Immunofluorescence

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Skeletal muscle hyperammonemia does not alter GSK3β expression or activity. (A to C) Representative immunoblots of phosphorylated and total GSK3β from untreated (UnT) C2C12 myotubes or those treated with 10 mM AmAc for 6 or 24 h (A), skeletal muscle from portocaval anastomosis (PCA) and sham-operated pair-fed control (Sham) rats (n = 5 each) (B), and skeletal muscle of patients with cirrhosis (CIR) and controls (CTL) (n = 5 each) (C). (D) Representative photomicrographs and myotube diameters of differentiated C2C12 myotubes depleted of GSK3β or GSK3α or transfected with a vector with a random construct (shRan), treated with and without 10 mM ammonium acetate (AmAc). Scale bars, 40 μm. (E) Representative immunoblots of dephosphorylated active (A) and total (T) β-catenin, as well as GSK3β, in untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h in the presence or absence of GSK3β inhibitors, 5 mM lithium chloride (LiCl) or 2 μM BIO (6-bromoindirubin-3′-oxime), that activate β-catenin. Densitometry of blots from active β-catenin were normalized to β-actin. (F) Representative immunoblots of GSK3α and GSK3β and immunoblots and densitometry of RPL5, RPL23, RPL32, P70S6K, and β-actin in myotubes with silencing of GSK3α and GSK3β with and without 10 mM AmAc for 24 h. Expression of total P70S6K was used to determine the response of a nonhousekeeping, regulatable protein with hyperammonemia. All cellular experiments were performed in at least 3 biological replicates, blots were normalized to β-actin, and data are expressed as means ± SD. **, P < 0.01; ***, P < 0.001 (versus untreated cells). The antibody against active β-catenin recognizes the unphosphorylated, stable form of β-catenin.

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Expressing, Activity Assay, Western Blot, Control, Transfection, Plasmid Preparation, Construct

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Hyperammonemia effects on ribosomal proteins are mediated by GSK- and mTORC1-independent effects. (A) Luciferase activity measuring transcriptional activity of β-catenin using the Topflash reporter assay (normalized to Renilla) comparing untreated (UnT) myotubes and those treated for 24 h with 10 mM AmAc in the presence or absence of 5 mM LiCl or 2 μM BIO. Data are depicted as fold changes over Topflash activity. (B) Representative immunoblots for β-catenin phosphorylated at Ser33/37 in untreated C2C12 myotubes or those treated with 10 mM AmAc for 6 or 24 h. Proteasome activity was blocked with 10 μM MG132 for the last 1 h to prevent ubiquitin-mediated degradation of phosphorylated β-catenin. (C) Fold changes in mRNAs for RPL5, -23, and -32 in myotubes treated for 24 h with and without 10 mM AmAc and/or rapamycin (Rap) (1 μg/ml). (D) Representative immunoblots of phosphorylated P70S6 kinase in response to 10 mM ammonium acetate for 24 h or 1 μg/ml rapamycin. All cellular experiments were performed in at least 3 biological replicates, blots were normalized to β-actin, and data are expressed as means ± SD. **, P < 0.01; ***, P < 0.001 (versus untreated cells). The antibody against active β-catenin recognizes the unphosphorylated, stable form of β-catenin.

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Luciferase, Activity Assay, Reporter Assay, Western Blot, Ubiquitin Proteomics

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Skeletal muscle IKKβ is a novel β-catenin kinase during hyperammonemia. (A) Representative immunoblotting and densitometry of active dephosphorylated and total β-catenin, cMYC, and UBF1 in C2C12 myotubes transfected with shRNAs targeting IKKβ or a scrambled shRNA (shRan) that were either untreated (UnT) or treated with 10 mM AmAc for 24 h. (B) Representative immunoblots of IKKβ and IKKα and immunoblots and densitometry of total and active β-catenin in untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h, stably expressing IKKβ or IKKα shRNA or a scrambled control (shRan). (C) Representative photomicrographs and myotube diameters of differentiated C2C12 myotubes depleted of IKKα or IKKβ or transfected with a vector with a random construct (shRan), treated with and without 10 mM AmAc. Scale bars, 40 μm. (D) Representative photomicrographs of immunofluorescence of active, dephosphorylated β-catenin expression (red) in myotubes stably expressing shRNAs targeting IKKβ or IKKα or a scrambled shRNA (shRan) that were either untreated or treated with 10 mM AmAc for 24 h. Nuclei were counterstained with DAPI (blue). Scale bars, 40 μm. (E) Luciferase activity for β-catenin transcriptional activity quantified by a Topflash assay (normalized to Renilla) in untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h, stably expressing either an shRNA targeting IKKβ shRNA or a scrambled control (shRan). All cellular experiments were performed in at least 3 biological replicates, all blots were normalized to β-actin, and data are expressed as means ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001 (shIKKβ versus shRan). The antibody against active β-catenin recognizes the unphosphorylated, stable form of β-catenin. Bars, 40 μm.

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Western Blot, Transfection, shRNA, Stable Transfection, Expressing, Control, Plasmid Preparation, Construct, Immunofluorescence, Luciferase, Activity Assay, TOPFlash assay

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Hyperammonemia regulates β-catenin via IKKβ. (A) [3H]phenylalanine incorporation in untreated myotubes and those treated for 24 h with AmAc and depleted of IKKβ or IKKα showing a partial reversal of AmAc-induced protein synthesis with silencing of IKKβ. (B) Immunoprecipitate of β-catenin probed for IKKβ and immunoprecipitate of IKKβ probed for β-catenin in untreated (UnT) murine C2C12 myotubes or those treated with 10 mM AmAc for 24 h. (C) Immunoprecipitate of IKKβ probed for β-catenin and immunoprecipitate of β-catenin probed for IKKβ in untreated HEK cells or those treated with 10 mM AmAc for 24 h. (D) Representative immunoblotting and densitometry of total β-catenin levels in C2C12 myotubes stably transfected with β-catenin mutants that are resistant to GSK3β phosphorylation (S33Y, S45Y, and N-terminal deletion [ΔN-ter] constructs). The β-catenin N-terminal deletion construct has a lower molecular weight. (E) In vitro kinase assay with purified β-catenin and either IKKβ or GSK3β (positive control) and negative controls. The blots were probed with phospho-β-catenin (Ser33/37/41) antibody. The purity of reagents was tested by immunoblotting. All cellular experiments and in vitro kinase assays were performed in at least 3 biological replicates, all blots were normalized to β-actin, and data are expressed as means ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001; NS, not significant (versus mock-transfected untreated control myotubes).

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Western Blot, Stable Transfection, Transfection, Phospho-proteomics, Construct, Molecular Weight, In Vitro, Kinase Assay, Purification, Positive Control, Control

Journal: Molecular and Cellular Biology

Article Title: Impaired Ribosomal Biogenesis by Noncanonical Degradation of β-Catenin during Hyperammonemia

doi: 10.1128/MCB.00451-18

Figure Lengend Snippet: Overexpression of β-catenin restores reduced cMYC and protein synthesis. (A) Representative immunoblotting and densitometry of total (T) and active (A) β-catenin, cMYC, and UBF1 in untreated (UnT) or 10 mM AmAc-treated murine C2C12 myotubes overexpressing wild-type β-catenin or a mock construct. (B) Representative immunoblotting and densitometry of ribosomal proteins RPL5, RPL23, and RPL32 in untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h, stably overexpressing either wild-type β-catenin or a mock construct. (C) Representative immunoblotting and densitometry of puromycin incorporation in untreated C2C12 myotubes or those treated with 10 mM AmAc for 24 h, overexpressing wild-type β-catenin or a mock construct. (D) Relative fold changes in 45S rRNA expression in untreated myotubes or those treated with 10 mM AmAc for 24 h, overexpressing wild-type β-catenin or a mock vector. (E) Representative photomicrographs and myotube diameters of differentiated C2C12 myotubes with β-catenin overexpression compared with mock vector-transfected myotubes treated with and without 10 mM AmAc. Scale bars, 40 μm. All cellular experiments were performed in at least 3 biological replicates, all blots were normalized to β-actin, and data are expressed as means ± SD. ***, P < 0.001 (mock versus β-catenin overexpression). The antibody against active β-catenin recognizes the unphosphorylated, stable form of β-catenin.

Article Snippet: In vitro cell culture studies were performed in differentiated C2C12 myotubes (ATCC CRL 1722; ATCC, Manassas, VA) as described by us previously ( 39 ).

Techniques: Over Expression, Western Blot, Construct, Stable Transfection, Expressing, Plasmid Preparation, Transfection

Journal: Scientific Reports

Article Title: Noninvasive PET imaging of LPS-induced oxidative stress in skeletal muscle using a ROS-targeting radiotracer

doi: 10.1038/s41598-026-35489-3

Figure Lengend Snippet: [¹⁸F]ROStrace uptake in C2C12 myotubes under oxidative stress conditions. ( a ) Time-dependent uptake of [¹⁸F]ROStrace in LPS-treated C2C12 myotubes. Cells were incubated with the tracer for 10, 30, 60, and 120 min, and intracellular radioactivity was measured using a gamma counter ( n = 5 per time point). Uptake is expressed as the percentage of the injected dose per well (%ID). ( b ) Comparative uptake of [¹⁸F]ROStrace after 60 min of incubation in C2C12 myotubes treated with LPS (0.2 mg/mL), or pretreated with N -acetylcysteine (NAC, 3 mM) or piperlongumine (PL, 10 µM). LPS-treated myotubes showed significantly higher uptake than untreated controls ( p = 0.0005, Cohen’s d = 3.54, 95% CI [− 3.627, − 1.509]), while NAC pretreatment reduced tracer uptake ( p < 0.0001, Cohen’s d = 6.51, 95% CI [1.886, 2.974]). PL pretreatment resulted in significantly elevated uptake compared to untreated controls group ( p = 0.0051, Cohen’s d = 2.54, 95% CI [− 4.707, − 1.217]). Data are presented as mean ± standard deviation (SD); n = 5 for all groups.

Article Snippet: The morphology of C2C12 myoblasts and differentiated myotubes was observed using an optical microscope (CKX53, Olympus, Tokyo, Japan).

Techniques: Incubation, Radioactivity, Injection, Standard Deviation

Journal: Scientific Reports

Article Title: Noninvasive PET imaging of LPS-induced oxidative stress in skeletal muscle using a ROS-targeting radiotracer

doi: 10.1038/s41598-026-35489-3

Figure Lengend Snippet: Biological and structural alterations in LPS-treated C2C12 myotubes. ( a ) Representative phase-contrast images of C2C12 myoblasts, differentiated myotubes, and LPS-treated myotubes (0.2 mg/mL, 24 h). Scale bar = 100 μm. ( b ) Quantification of myotube width in control and LPS-treated groups ( n = 3, p = 0.0183, Cohen’s d = 3.14, 95% CI [1.537, 9.496]). ( c ) Representative fluorescence images of MitoTracker Red CMXRos-stained myoblasts, myotubes, and LPS-treated myotubes. Scale bar = 100 μm. ( d ) Quantification of MitoTracker fluorescence intensity relative to myoblasts ( n = 3; myoblast vs. myotube, p = 0.0003, Cohen’s d = 9.63, 95% CI [− 66.52, − 41.16]; myotube vs. myotube + LPS, p = 0.009, Cohen’s d = 3.87, 95% CI [14.39, 55.00]). ( e ) Relative mRNA expression levels of MuRF-1 ( p = 0.0454, Cohen’s d = 2.34, 95% CI [− 0.8699, − 0.01472]) and Atrogin-1 ( p = 0.0494, Cohen’s d = 2.28, 95% CI [− 0.3060, − 0.0006591]) in control and LPS-treated myotubes assessed by RT-qPCR ( n = 3). Data are presented as mean ± SD.

Article Snippet: The morphology of C2C12 myoblasts and differentiated myotubes was observed using an optical microscope (CKX53, Olympus, Tokyo, Japan).

Techniques: Control, Fluorescence, Staining, Expressing, Quantitative RT-PCR

Journal: Scientific Reports

Article Title: Noninvasive PET imaging of LPS-induced oxidative stress in skeletal muscle using a ROS-targeting radiotracer

doi: 10.1038/s41598-026-35489-3

Figure Lengend Snippet: Assessment of ROS levels in C2C12 myotubes using DHE fluorescence. ( a ) Representative fluorescence images of C2C12 myotubes stained with dihydroethidium (DHE; 20 µM, 30 min) in control and LPS-treated groups. Scale bar = 100 μm. ( b ) Quantification of DHE fluorescence intensity. LPS-treated myotubes exhibited increased fluorescence compared to controls, although the difference was not statistically significant ( n = 9, p = 0.0079, Cohen’s d = 1.43, 95% CI [− 131.1, − 23.29]). Data are presented as mean ± standard deviation (SD).

Article Snippet: The morphology of C2C12 myoblasts and differentiated myotubes was observed using an optical microscope (CKX53, Olympus, Tokyo, Japan).

Techniques: Fluorescence, Staining, Control, Standard Deviation